🏁 libssw - fast SIMD parallelized implementation of the Smith-Waterman algorithm - for Ruby
gem install libssw
Set the environment variable LIBSSWDIR to specify the location of the shared library.
For example, on Ubuntu, you can use libssw in the following way.
sudo apt install libssw-dev
export LIBSSWDIR=/usr/lib/x86_64-linux-gnu/ # libssw.so
When installing from source code using the following steps, the shared library libssw.so or libssw.dylib will be packed in the Ruby gem. In this case, the environment variable LIBSSWDIR is not required.
git clone --recursive https://github.com/kojix2/ruby-libssw
bundle exec rake libssw:build
bundle exec rake installruby-libssw does not support Windows.
require 'libssw'
ref_str = "AAAAAAAAACGTTAAAAAAAAAA"
ref_int = SSW::DNA.to_int_array(ref_str)
# [0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 2, 3, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]
read_str1 = "ACGTT"
read_str2 = SSW::DNA.revcomp(read_str1)
# "AACGT"
read_int1 = SSW::DNA.to_int_array(read_str1)
# [0, 1, 2, 3, 3]
read_int2 = SSW::DNA.to_int_array(read_str2)
# [0, 0, 1, 2, 3]
mat = SSW.create_scoring_matrix(SSW::DNA::Elements, 2, -2)
# mat = [2, -2, -2, -2, 0,
# -2, 2, -2, -2, 0,
# -2, -2, 2, -2, 0,
# -2, -2, -2, 2, 0,
# 0, 0, 0, 0, 0]
profile1 = SSW.init(read_int1, mat)
align1 = SSW.align(profile1, ref_int, 3, 1, 1, 0, 0)
pp align1.to_h
# {
# :score1 => 10,
# :score2 => 0,
# :ref_begin1 => 8,
# :ref_end1 => 12,
# :read_begin1 => 0,
# :read_end1 => 4,
# :ref_end2 => 0,
# :cigar => [80],
# :cigar_len => 1,
# :cigar_string => "5M"
# }
profile2 = SSW.init(read_int2, mat)
align2 = SSW.align(profile2, ref_int, 3, 1, 1, 0, 0)
pp align2.to_h
# {
# :score1 => 10,
# :score2 => 0,
# :ref_begin1 => 7,
# :ref_end1 => 11,
# :read_begin1 => 0,
# :read_end1 => 4,
# :ref_end2 => 0,
# :cigar => [80],
# :cigar_len => 1,
# :cigar_string => "5M"
# }
puts SSW.build_path(read_str1, ref_str, align1)
# 5M
# ACGTT
# |||||
# ACGTTSee API Documentation.
- SSW module
- SSW.init
- SSW.init_destroy
- SSW.align
- SSW.align_destroy
- SSW.mark_mismatch
- SSW.create_scoring_matrix
- SSW.build_path
- Profile class
- attributes
- read, mat, read_len, n, bias
- Align class
- attributes
- score1, score2, ref_begin1, ref_end1, read_begin1, read_end1, ref_end2
cigar, cigar_len, cigar_string
- DNA module
- DNA.to_int_array
- DNA.from_int_array
- revcomp
- AASeq module
- AASeq.to_int_array
- AASeq.from_int_array
- BLOSUM62
- BLOSUM50git clone --recursive https://github.com/kojix2/ruby-libssw
bundle exec rake libssw:build
bundle exec rake testDo you need commit rights to my repository?
Do you want to get admin rights and take over the project?
If so, please feel free to contact me @kojix2.
- Report bugs
- Fix bugs and submit pull requests
- Write, clarify, or fix documentation
- English corrections are welcome
- Suggest or add new features